4x sds page loading dye (Thermo Fisher)
Structured Review

4x Sds Page Loading Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/4x+sds+loading+dye/Laemmli+SDS+sample+buffer%2C+reducing/bio_rxiv__64898__2026__06__05__730395-467-9-43
Average 99 stars, based on 1 article reviews
Images
1) Product Images from "Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complex"
Article Title: Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complex
Journal: bioRxiv
doi: 10.64898/2026.06.05.730395
Figure Legend Snippet: a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b , SDS-PAGE analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
Techniques Used: Construct, Ubiquitin Proteomics, Variant Assay, SDS Page, Incubation, Activity Assay, Silver Staining, Fluorescence, Staining, Molecular Weight
Figure Legend Snippet: a , K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or the indicated ARISC variants (5 nM) for 60 minutes. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. b, SDS-PAGE analysis of ARISC(E33A)–RAP80, ARISC(E33A) BRCC36(S98K) –RAP80, ARISC(E33A) Abraxas1(Δ42-55) –RAP80, and ARISC(E33A) BRCC45(ΔLoop) –RAP80. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. c, Spectral shift assays measuring binding of labelled ARISC(E33A)–RAP80 or the indicated mutant complexes (40 nM) to cyclical K63-Ub6 chains (20 µM-0 µM). Data points are mean ± SEM of two independent experiments carried out in technical duplicates. Dissociation constants (K d ) are indicated; CI, confidence interval. d, Representative images of WT or mutants BRCC36 IRIF in HT-29 cells 4 h post irradiation (10 Gy). Scale bar is 10 µm. e, Western blots showing BRCC36 protein levels in HT-29 cells reconstituted with WT or mutants BRCC36 as indicated (l eft ). Scatter plot showing quantification of the BRCC36 IRIF described in d . Data represent mean ± SEM derived from n ≥ 300 nuclei examined over two independent experiments; p values are indicated, unpaired two-tailed t test ( right ). f, K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or ARISC Δ42-55 (Abraxas1 Δ42-55) (5 nM) for up to 60 minutes. Cleavage activity was analysed as in a . Data are representative of two independent experiments. DUB, deubiquitylating enzyme; WT, wild type; Ub, ubiquitin.
Techniques Used: Incubation, Activity Assay, SDS Page, Silver Staining, Binding Assay, Mutagenesis, Irradiation, Western Blot, Derivative Assay, Two Tailed Test, Ubiquitin Proteomics
Related Articles
Purification:Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding Recombinant:Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding Electrophoresis:Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding Staining:Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding Real-time Polymerase Chain Reaction:Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs. Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with Western Blot:Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs. Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with Filtration:Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs. Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with Size-exclusion Chromatography:Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs. Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with Bicinchoninic Acid Protein Assay:Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs. Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with Sonication:Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs. Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with |