Review



4x sds page loading dye  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Thermo Fisher 4x sds page loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    4x Sds Page Loading Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/Laemmli+SDS+sample+buffer%2C+reducing/bio_rxiv__64898__2026__06__05__730395-467-9-43
    Average 99 stars, based on 1 article reviews
    4x sds page loading dye - by Bioz Stars, 2026-09
    99/100 stars

    Images

    1) Product Images from "Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complex"

    Article Title: Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complex

    Journal: bioRxiv

    doi: 10.64898/2026.06.05.730395

    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b , SDS-PAGE analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    Figure Legend Snippet: a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b , SDS-PAGE analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.

    Techniques Used: Construct, Ubiquitin Proteomics, Variant Assay, SDS Page, Incubation, Activity Assay, Silver Staining, Fluorescence, Staining, Molecular Weight

    a , K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or the indicated ARISC variants (5 nM) for 60 minutes. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. b, SDS-PAGE analysis of ARISC(E33A)–RAP80, ARISC(E33A) BRCC36(S98K) –RAP80, ARISC(E33A) Abraxas1(Δ42-55) –RAP80, and ARISC(E33A) BRCC45(ΔLoop) –RAP80. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. c, Spectral shift assays measuring binding of labelled ARISC(E33A)–RAP80 or the indicated mutant complexes (40 nM) to cyclical K63-Ub6 chains (20 µM-0 µM). Data points are mean ± SEM of two independent experiments carried out in technical duplicates. Dissociation constants (K d ) are indicated; CI, confidence interval. d, Representative images of WT or mutants BRCC36 IRIF in HT-29 cells 4 h post irradiation (10 Gy). Scale bar is 10 µm. e, Western blots showing BRCC36 protein levels in HT-29 cells reconstituted with WT or mutants BRCC36 as indicated (l eft ). Scatter plot showing quantification of the BRCC36 IRIF described in d . Data represent mean ± SEM derived from n ≥ 300 nuclei examined over two independent experiments; p values are indicated, unpaired two-tailed t test ( right ). f, K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or ARISC Δ42-55 (Abraxas1 Δ42-55) (5 nM) for up to 60 minutes. Cleavage activity was analysed as in a . Data are representative of two independent experiments. DUB, deubiquitylating enzyme; WT, wild type; Ub, ubiquitin.
    Figure Legend Snippet: a , K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or the indicated ARISC variants (5 nM) for 60 minutes. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. b, SDS-PAGE analysis of ARISC(E33A)–RAP80, ARISC(E33A) BRCC36(S98K) –RAP80, ARISC(E33A) Abraxas1(Δ42-55) –RAP80, and ARISC(E33A) BRCC45(ΔLoop) –RAP80. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. c, Spectral shift assays measuring binding of labelled ARISC(E33A)–RAP80 or the indicated mutant complexes (40 nM) to cyclical K63-Ub6 chains (20 µM-0 µM). Data points are mean ± SEM of two independent experiments carried out in technical duplicates. Dissociation constants (K d ) are indicated; CI, confidence interval. d, Representative images of WT or mutants BRCC36 IRIF in HT-29 cells 4 h post irradiation (10 Gy). Scale bar is 10 µm. e, Western blots showing BRCC36 protein levels in HT-29 cells reconstituted with WT or mutants BRCC36 as indicated (l eft ). Scatter plot showing quantification of the BRCC36 IRIF described in d . Data represent mean ± SEM derived from n ≥ 300 nuclei examined over two independent experiments; p values are indicated, unpaired two-tailed t test ( right ). f, K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or ARISC Δ42-55 (Abraxas1 Δ42-55) (5 nM) for up to 60 minutes. Cleavage activity was analysed as in a . Data are representative of two independent experiments. DUB, deubiquitylating enzyme; WT, wild type; Ub, ubiquitin.

    Techniques Used: Incubation, Activity Assay, SDS Page, Silver Staining, Binding Assay, Mutagenesis, Irradiation, Western Blot, Derivative Assay, Two Tailed Test, Ubiquitin Proteomics

    Related Articles

    Purification:

    Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches
    Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding 4x SDS loading dye (200 mM Tris-HCl pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol, 50 mM EDTA, 0.08% bromophenol blue) and boiling at 95°C for 5 min 10 μL of each sample was loaded into each well of NuPAGE 4 to 12% (ThermoFisher) and the proteins were separated by electrophoresis at 120 V for 2 h. Part of the gel was excised and stained with InstantBlue (expedeon). .. The other part was transferred to PVDF membrane (Bio-Rad) via wet transfer with XCell II Blot module at 100V for 2 h. Membranes were washed in TBST (25 mM Tris-HCL pH7.5, 300 mM NaCl, 0.05% Tween 20), blocked in 5% BSA/TBS for 1 h at RT, and incubated with depleted human serum or purified antibodies diluted 1:1000 in 5% BSA/TBST for 1 h at RT.

    Recombinant:

    Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches
    Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding 4x SDS loading dye (200 mM Tris-HCl pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol, 50 mM EDTA, 0.08% bromophenol blue) and boiling at 95°C for 5 min 10 μL of each sample was loaded into each well of NuPAGE 4 to 12% (ThermoFisher) and the proteins were separated by electrophoresis at 120 V for 2 h. Part of the gel was excised and stained with InstantBlue (expedeon). .. The other part was transferred to PVDF membrane (Bio-Rad) via wet transfer with XCell II Blot module at 100V for 2 h. Membranes were washed in TBST (25 mM Tris-HCL pH7.5, 300 mM NaCl, 0.05% Tween 20), blocked in 5% BSA/TBS for 1 h at RT, and incubated with depleted human serum or purified antibodies diluted 1:1000 in 5% BSA/TBST for 1 h at RT.

    Electrophoresis:

    Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches
    Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding 4x SDS loading dye (200 mM Tris-HCl pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol, 50 mM EDTA, 0.08% bromophenol blue) and boiling at 95°C for 5 min 10 μL of each sample was loaded into each well of NuPAGE 4 to 12% (ThermoFisher) and the proteins were separated by electrophoresis at 120 V for 2 h. Part of the gel was excised and stained with InstantBlue (expedeon). .. The other part was transferred to PVDF membrane (Bio-Rad) via wet transfer with XCell II Blot module at 100V for 2 h. Membranes were washed in TBST (25 mM Tris-HCL pH7.5, 300 mM NaCl, 0.05% Tween 20), blocked in 5% BSA/TBS for 1 h at RT, and incubated with depleted human serum or purified antibodies diluted 1:1000 in 5% BSA/TBST for 1 h at RT.

    Staining:

    Article Title: The characteristics of pre-existing humoral imprint determine efficacy of S. aureus vaccines and support alternative vaccine approaches
    Article Snippet: Fluorescence intensity was analyzed by FACSCanto (BD Biosciences) and FCS Express software ( De Novo software). .. Purified antibodies or recombinant ClfA were denatured by adding 4x SDS loading dye (200 mM Tris-HCl pH 6.8, 8% SDS, 40% glycerol, 4% β-mercaptoethanol, 50 mM EDTA, 0.08% bromophenol blue) and boiling at 95°C for 5 min 10 μL of each sample was loaded into each well of NuPAGE 4 to 12% (ThermoFisher) and the proteins were separated by electrophoresis at 120 V for 2 h. Part of the gel was excised and stained with InstantBlue (expedeon). .. The other part was transferred to PVDF membrane (Bio-Rad) via wet transfer with XCell II Blot module at 100V for 2 h. Membranes were washed in TBST (25 mM Tris-HCL pH7.5, 300 mM NaCl, 0.05% Tween 20), blocked in 5% BSA/TBS for 1 h at RT, and incubated with depleted human serum or purified antibodies diluted 1:1000 in 5% BSA/TBST for 1 h at RT.

    Real-time Polymerase Chain Reaction:

    Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs.
    Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with 4x SDS-loading dye (240 mM Tris/HCl, pH 6.8, 8% SDS, 40% glycerol, 0.05% bromophenolblue, 5% ß-Mercaptoethanol) after Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) or NTA analysis, heated to 95°C for 10 min and subsequently sonicated. .. Cell pellets of human dermal fibroblasts were lysed in 1 x TNE buffer (2 x TNE: 100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 2 % Triton X-100) or RIPA M AN US CR IP T AC CE PT ED 5 buffer (150 mM NaCl, 1 % NP-40 substitute, 0.5 % Deoxycholic acid, 0.1 % SDS, 20 % SDS, 50 mM Tris, pH 8.0) and protein concentration was quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) according to manufacturer’s recommendations.

    Western Blot:

    Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs.
    Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with 4x SDS-loading dye (240 mM Tris/HCl, pH 6.8, 8% SDS, 40% glycerol, 0.05% bromophenolblue, 5% ß-Mercaptoethanol) after Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) or NTA analysis, heated to 95°C for 10 min and subsequently sonicated. .. Cell pellets of human dermal fibroblasts were lysed in 1 x TNE buffer (2 x TNE: 100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 2 % Triton X-100) or RIPA M AN US CR IP T AC CE PT ED 5 buffer (150 mM NaCl, 1 % NP-40 substitute, 0.5 % Deoxycholic acid, 0.1 % SDS, 20 % SDS, 50 mM Tris, pH 8.0) and protein concentration was quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) according to manufacturer’s recommendations.

    Filtration:

    Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs.
    Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with 4x SDS-loading dye (240 mM Tris/HCl, pH 6.8, 8% SDS, 40% glycerol, 0.05% bromophenolblue, 5% ß-Mercaptoethanol) after Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) or NTA analysis, heated to 95°C for 10 min and subsequently sonicated. .. Cell pellets of human dermal fibroblasts were lysed in 1 x TNE buffer (2 x TNE: 100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 2 % Triton X-100) or RIPA M AN US CR IP T AC CE PT ED 5 buffer (150 mM NaCl, 1 % NP-40 substitute, 0.5 % Deoxycholic acid, 0.1 % SDS, 20 % SDS, 50 mM Tris, pH 8.0) and protein concentration was quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) according to manufacturer’s recommendations.

    Size-exclusion Chromatography:

    Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs.
    Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with 4x SDS-loading dye (240 mM Tris/HCl, pH 6.8, 8% SDS, 40% glycerol, 0.05% bromophenolblue, 5% ß-Mercaptoethanol) after Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) or NTA analysis, heated to 95°C for 10 min and subsequently sonicated. .. Cell pellets of human dermal fibroblasts were lysed in 1 x TNE buffer (2 x TNE: 100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 2 % Triton X-100) or RIPA M AN US CR IP T AC CE PT ED 5 buffer (150 mM NaCl, 1 % NP-40 substitute, 0.5 % Deoxycholic acid, 0.1 % SDS, 20 % SDS, 50 mM Tris, pH 8.0) and protein concentration was quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) according to manufacturer’s recommendations.

    Bicinchoninic Acid Protein Assay:

    Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs.
    Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with 4x SDS-loading dye (240 mM Tris/HCl, pH 6.8, 8% SDS, 40% glycerol, 0.05% bromophenolblue, 5% ß-Mercaptoethanol) after Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) or NTA analysis, heated to 95°C for 10 min and subsequently sonicated. .. Cell pellets of human dermal fibroblasts were lysed in 1 x TNE buffer (2 x TNE: 100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 2 % Triton X-100) or RIPA M AN US CR IP T AC CE PT ED 5 buffer (150 mM NaCl, 1 % NP-40 substitute, 0.5 % Deoxycholic acid, 0.1 % SDS, 20 % SDS, 50 mM Tris, pH 8.0) and protein concentration was quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) according to manufacturer’s recommendations.

    Sonication:

    Article Title: Extracellular Vesicles in Human Skin: Cross-Talk from Senescent Fibroblasts to Keratinocytes by miRNAs.
    Article Snippet: .. Primer used for qPCR: B2M sense: GAGATGTCTCGCTCCGTGG, B2M as: TACATGTCTCGATCCCACTTAAC; GAPDH sense: CGACCACTTTGTCAAGCTCA, GAPDH as: TGTGAGGAGGGGAGATTCAG E-cadherin sense: CCCACCACGTACAAGGGTC, E-cadherin as: CTGGGGTATTGGGGGCATC Plakophilin4/p0071 sense: AGGCTTGGAGCAGAATCACC, Plakophilin4/p0071 as: CCCTCACTTTCATGGAGAGATGT VIM sense: GGAGTCCACTGAGTACCGGA, VIM as: GCTTCAACGGCAAAGTTCTC Protein quantification, western blot and antibodies Crude skin section extracts or EVs enriched from skin sections by tangential flow filtration (TFF) with a 300 kDa cut-off or size exclusion chromatography (SEC) as well as TFF flow through were directly combined with 4x SDS-loading dye (240 mM Tris/HCl, pH 6.8, 8% SDS, 40% glycerol, 0.05% bromophenolblue, 5% ß-Mercaptoethanol) after Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) or NTA analysis, heated to 95°C for 10 min and subsequently sonicated. .. Cell pellets of human dermal fibroblasts were lysed in 1 x TNE buffer (2 x TNE: 100 mM Tris/HCl, pH 8.0, 300 mM NaCl, 1 mM EDTA, 2 % Triton X-100) or RIPA M AN US CR IP T AC CE PT ED 5 buffer (150 mM NaCl, 1 % NP-40 substitute, 0.5 % Deoxycholic acid, 0.1 % SDS, 20 % SDS, 50 mM Tris, pH 8.0) and protein concentration was quantified using the Pierce® BCA Protein Assay Kit (Thermo Scientific, USA, 23227) according to manufacturer’s recommendations.



    Similar Products

    4x sds page loading dye  (Thermo Fisher)
    99
    Thermo Fisher 4x sds page loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    4x Sds Page Loading Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/Laemmli+SDS+sample+buffer%2C+reducing/bio_rxiv__64898__2026__06__05__730395-467-9-43
    Average 99 stars, based on 1 article reviews
    4x sds page loading dye - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    4x sds loading dye  (Bio-Rad)
    99
    Bio-Rad 4x sds loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    4x Sds Loading Dye, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/4x+Laemmli+Sample+Buffer/bio_rxiv__64898__2026__03__09__710667-254-4-8
    Average 99 stars, based on 1 article reviews
    4x sds loading dye - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    a50591 sds loading dye  (Bio-Rad)
    99
    Bio-Rad a50591 sds loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    A50591 Sds Loading Dye, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/4x+Laemmli+Sample+Buffer/pm41043433-219-34-42
    Average 99 stars, based on 1 article reviews
    a50591 sds loading dye - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    4x sds gel loading dye  (Bio-Rad)
    98
    Bio-Rad 4x sds gel loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    4x Sds Gel Loading Dye, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/SDS/bio_rxiv__2025__08__01__668200-181-13-33
    Average 98 stars, based on 1 article reviews
    4x sds gel loading dye - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier
    sds page loading dye  (Bio-Rad)
    99
    Bio-Rad sds page loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    Sds Page Loading Dye, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/4x+Laemmli+Sample+Buffer/pmc12259467-268-5-8
    Average 99 stars, based on 1 article reviews
    sds page loading dye - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    4x sds loading dye  (Thermo Fisher)
    86
    Thermo Fisher 4x sds loading dye
    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b <t>,</t> <t>SDS-PAGE</t> analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.
    4x Sds Loading Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/4x+sds+loading+dye/bio_rxiv__2024__08__11__607481-252-21-24
    Average 86 stars, based on 1 article reviews
    4x sds loading dye - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b , SDS-PAGE analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.

    Journal: bioRxiv

    Article Title: Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complex

    doi: 10.64898/2026.06.05.730395

    Figure Lengend Snippet: a , Domain architecture of RAP80 and ARISC constructs. FL, full-length; SIM, small ubiquitin-like modifier (SUMO)-interacting motif; UIM, ubiquitin-interacting motif; AIR, Abraxas1-interacting region; ZnF, zinc finger; MPN, Mpr1, Pad1 N-terminal; CC, coiled coil; UEV, ubiquitin E2 variant; vWFA, von Willebrand factor type A ( left ). Schematics of indicated complexes ( right ). b , SDS-PAGE analysis of ARISC, ARISC–RAP80, and ARISC–RAP80 AIR. c , K63-linked ubiquitin chains (1 µM) were incubated with ARISC or ARISC–RAP80 (5 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. d , K63-Ub2, -Ub4, and - Ub7 chains (1 µM) were incubated with ARISC, ARISC–RAP80, or ARISC–RAP80 AIR (5 nM) for the indicated time points. Cleavage activity was analysed as in c . Data are representative of three independent experiments. e , Schematics ( left ) and SDS-PAGE analysis ( right ) of indicated complexes. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. f , Alexa-Fluor 488 (AF488) labelled distally (AF488- Cys Ub4 K63R ) blocked K63-Ub4 chains (1.5 µM) were incubated with ARISC–RAP80, ARISC–RAP80 ΔUIMs, or ARISC–RAP80 ΔZnF (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and fluorescence scanning ( left ; see Methods ). The disappearance of the K63-Ub4 parent band was quantified using densitometry, and plotted as fraction of substrate consumed (%). Data points are mean ± SEM of two independent experiments ( right ). g , Cyclical and linear K63-Ub5 chains (2 µM) were incubated with ARISC or ARISC–RAP80 (10 nM) for the indicated time points. Cleavage activity was analysed by SDS-PAGE and Oriole staining. Data are representative of two independent experiments. Ub, ubiquitin; DUB, deubiquitylating enzyme. * indicates lower molecular weight ubiquitin species.

    Article Snippet: Reactions were stopped with the addition of 3 μL 4x SDS-PAGE loading dye [240 mM Tris-HCl pH 6.8, 40% (v/v) glycerol, 8% (w/v) SDS, 0.04% (w/v) bromophenol blue, and 5% (v/v) β-Mercaptoethanol], and products were separated on 4-12% or 12% Nu-PAGE Bis-Tris gels (Invitrogen).

    Techniques: Construct, Ubiquitin Proteomics, Variant Assay, SDS Page, Incubation, Activity Assay, Silver Staining, Fluorescence, Staining, Molecular Weight

    a , K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or the indicated ARISC variants (5 nM) for 60 minutes. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. b, SDS-PAGE analysis of ARISC(E33A)–RAP80, ARISC(E33A) BRCC36(S98K) –RAP80, ARISC(E33A) Abraxas1(Δ42-55) –RAP80, and ARISC(E33A) BRCC45(ΔLoop) –RAP80. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. c, Spectral shift assays measuring binding of labelled ARISC(E33A)–RAP80 or the indicated mutant complexes (40 nM) to cyclical K63-Ub6 chains (20 µM-0 µM). Data points are mean ± SEM of two independent experiments carried out in technical duplicates. Dissociation constants (K d ) are indicated; CI, confidence interval. d, Representative images of WT or mutants BRCC36 IRIF in HT-29 cells 4 h post irradiation (10 Gy). Scale bar is 10 µm. e, Western blots showing BRCC36 protein levels in HT-29 cells reconstituted with WT or mutants BRCC36 as indicated (l eft ). Scatter plot showing quantification of the BRCC36 IRIF described in d . Data represent mean ± SEM derived from n ≥ 300 nuclei examined over two independent experiments; p values are indicated, unpaired two-tailed t test ( right ). f, K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or ARISC Δ42-55 (Abraxas1 Δ42-55) (5 nM) for up to 60 minutes. Cleavage activity was analysed as in a . Data are representative of two independent experiments. DUB, deubiquitylating enzyme; WT, wild type; Ub, ubiquitin.

    Journal: bioRxiv

    Article Title: Mechanism of K63-linked polyubiquitin recognition and cleavage by the BRCA1-A complex

    doi: 10.64898/2026.06.05.730395

    Figure Lengend Snippet: a , K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or the indicated ARISC variants (5 nM) for 60 minutes. Cleavage activity was analysed by SDS-PAGE and silver staining. Data are representative of two independent experiments. b, SDS-PAGE analysis of ARISC(E33A)–RAP80, ARISC(E33A) BRCC36(S98K) –RAP80, ARISC(E33A) Abraxas1(Δ42-55) –RAP80, and ARISC(E33A) BRCC45(ΔLoop) –RAP80. dStrepII, double StrepII tag. * indicates Abraxas1 degradation product. c, Spectral shift assays measuring binding of labelled ARISC(E33A)–RAP80 or the indicated mutant complexes (40 nM) to cyclical K63-Ub6 chains (20 µM-0 µM). Data points are mean ± SEM of two independent experiments carried out in technical duplicates. Dissociation constants (K d ) are indicated; CI, confidence interval. d, Representative images of WT or mutants BRCC36 IRIF in HT-29 cells 4 h post irradiation (10 Gy). Scale bar is 10 µm. e, Western blots showing BRCC36 protein levels in HT-29 cells reconstituted with WT or mutants BRCC36 as indicated (l eft ). Scatter plot showing quantification of the BRCC36 IRIF described in d . Data represent mean ± SEM derived from n ≥ 300 nuclei examined over two independent experiments; p values are indicated, unpaired two-tailed t test ( right ). f, K63-Ub2, -Ub4, and -Ub7 chains (1 µM) were incubated with ARISC WT or ARISC Δ42-55 (Abraxas1 Δ42-55) (5 nM) for up to 60 minutes. Cleavage activity was analysed as in a . Data are representative of two independent experiments. DUB, deubiquitylating enzyme; WT, wild type; Ub, ubiquitin.

    Article Snippet: Reactions were stopped with the addition of 3 μL 4x SDS-PAGE loading dye [240 mM Tris-HCl pH 6.8, 40% (v/v) glycerol, 8% (w/v) SDS, 0.04% (w/v) bromophenol blue, and 5% (v/v) β-Mercaptoethanol], and products were separated on 4-12% or 12% Nu-PAGE Bis-Tris gels (Invitrogen).

    Techniques: Incubation, Activity Assay, SDS Page, Silver Staining, Binding Assay, Mutagenesis, Irradiation, Western Blot, Derivative Assay, Two Tailed Test, Ubiquitin Proteomics